cdna samples (Bio-Rad)

Bio-Rad is a verified supplier

Bio-Rad manufactures this product

About

News

Press Release

Team

Advisors

Partners

Contact

Bioz Stars

Bioz vStars

Buy from Supplier

Structured Review

Bio-Rad cdna samples
Cdna Samples, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 92/100, based on 16 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/control+cdna+sample/Liquichek+Rheumatoid+Factor+Control/ppr0220352-259-36-15
Average 92 stars, based on 16 article reviews

cdna samples - by Bioz Stars, 2026-11

92/100 stars

Images

Real-time Polymerase Chain Reaction:

Article Title: Transcriptional determinism and stochasticity contribute to the complexity of autism-associated SHANK family genes.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Acrosin Polyclonal Antibody (C-terminus) Invitrogen Cat #: PA5-114207; RRID: AB_2884721 Acrosin Polyclonal Antibody (N-terminus) Invitrogen Cat #: PA5-99580; RRID: AB_2818513 Biological samples Human Brain Tissue Mayo Clinic, Jacksonville, FL, 32224 USA Adults, n = 4 Human Brain Tissue Children’s Hospital of Fudan University, Shanghai, 201102 China Children, n = 4 Critical commercial assays NucleoZOLTM Takara Bio Cat #:740404.200 NucleoSpin RNA set for NucleoZOLTM Takara Bio Cat #: 740406.50 rDNase Set Takara Bio Cat #: 740963 NucleoSpin RNA Clean-up XS Takara Bio Cat #: 740903.50 RNA to cDNA EcoDryTM Premix kit Takara Bio Cat #: 639548 KAPA SYBR FAST qPCR Master Mix (2X) Universal Kapa Biosystems Cat #: KK4602 xGen Lockdown Probes Integrated DNA Technologies customized Iso-Seq Express Oligo Kit PACBIO PN 101-737-500 SMRTbell Express Template Prep Kit 2.0 PACBIO PN 100-938-900 Elution Buffer PACBIO PN 101-633-500 NEBNext Single Cell/Low Input cDNA Synthesis & Amplification Module NEB Cat #: E6421S NEBNext High-Fidelity 2X PCR Master Mix NEB Cat #: M0541S ProNex Beads Promega Cat #: NG2001 Qubit dsDNA HS Assay Kit Invitrogen Cat #: Q32851 NucleoSpin RNA/Protein Kit Takara Bio Cat #: 740933.50 Protein Quantification Assay Takara Bio Cat #: 740967.250 4x Laemmli buffer Bio-Rad Cat #: 1610747 4–20% Mini-PROTEAN TGX Stain-FreeTM Protein Gels Bio-Rad Cat #: 4568094 Deposited data Iso-Seq/RNA-Seq This study BioProject: PRJNA1066952 UCSC tracks This study https://doi.org/10.17632/n5vjjmwb9p.1 Tandem Mass Spectrometry This study https://doi.org/10.17632/n5vjjmwb9p.1 UCLA-ASD RNA-Seq PsychENCODE syn4921369 BrainVar RNA-Seq PsychENCODE syn21557948 BrainGVEX RNA-Seq PsychENCODE syn4590909 CMC RNA-Seq PsychENCODE syn22344687 LIDB RNA-Seq PsychENCODE syn12299750 CommonMind RNA-Seq PsychENCODE syn2759792 SMART scRNA-seq Yao et al.40 https://assets.nemoarchive.org/dat-jb2f34y ASC VCF Autism Sequencing Consortium https://asc.broadinstitute.org/downloads BipEx VCF Bipolar Exomes https://bipex.broadinstitute.org/downloads Epi25 VCF whole-exome sequencing case- control study of epilepsy https://epi25.broadinstitute.org/downloads (Continued on next page) Cell Reports 43, 114376, July 23, 2024 21 .. REAGENT or RESOURCE SOURCE IDENTIFIER SCHEMA VCF Schizophrenia exome meta- analysis consortium https://schema.broadinstitute.org/downloads Mouse brain Visium 10x Genomics FFPE Mouse Brain Coronal Section 1 Experimental models: Organisms/strains C57BL/6J Jackson Laboratory Strain #:000664 Shank3De21 Jackson Laboratory Shank3tm1.1Pfw/J, Strain #:018398 Shank3De4-9 Jiang Lab Wang et al.35 Shank3De4-22 Jiang Lab Wang et al.20 Software and algorithms Lima v2.5.0 PACBIO https://lima.how/ IsoSeq v3 PACBIO https://github.com/PacificBiosciences/IsoSeq pbmm2 PACBIO https://github.com/PacificBiosciences/pbmm2 SQANTI3 v4.3 Pardo-Palacios et al.107 https://github.com/ConesaLab/SQANTI3 fastp Chen et al.108 https://github.com/OpenGene/fastp HISAT 2.2.1 Kim et al.109 https://daehwankimlab.github.io/hisat2/download/ SAMtools Danecek et al.110 https://www.htslib.org/ FeatureCount Liao et al.111 https://rnnh.github.io/bioinfo-notebook/ docs/featureCounts.html Salmon 1.4.0 Patro et al.112 https://github.com/COMBINE-lab/ salmon/releases DEXSeq Anders et al.113 https://bioconductor.org/packages/ release/bioc/html/DEXSeq.html BCFtools v 1.16 Danecek et al.110 https://bioconda.github.io/recipes/ bcftools/README.html HTSlib v 1.16 Bonfield et al.114 https://www.htslib.org/download/ Tabix v 0.2.5 Li et al.115 https://github.com/samtools/tabix VEP, release 107 McLaren et al.74 https://github.com/Ensembl/ensembl-vep gnomAD, v3.1.2 Koch et al.75 https://gnomad.broadinstitute.org/ news/2021-10-gnomad-v3-12-minor-release/ SpliceAI Jaganathan et al.76 https://github.com/Illumina/SpliceAI SnpEff Cingolani et al.77 https://pcingola.github.io/SnpEff/ Cell Ranger 10x Genomics https://www.10xgenomics.com/support/ software/cell-ranger/latest Space Ranger v2.0 10x Genomics https://www.10xgenomics.com/support/ software/space-ranger/latest Genomics Loupe Visualization Software v6.5 10x Genomics https://www.10xgenomics.com/support/ software/loupe-browser/latest

Article Title: Oral delivery of nerolidol alleviates cyclophosphamide-induced renal inflammation, apoptosis, and fibrosis via modulation of NF-κB/cleaved caspase-3/TGF-β signaling molecules
Article Snippet: .. The PCR process was conducted using 20 μl of the prepared sample having one μl cDNA, 500 ng/μl final concentration of primer, and EvaGreen supermix qPCR obtained from Biorad. ..

Article Title: Centromere inactivation during aging can be rescued in human cells.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies CENP-A Abcam Cat# ab13939; RRID:AB_300766 CENP-B Abcam Cat# ab25734; RRID:AB_726801 CENP-C MBL International Cat# PD030;RRID:AB_10693556 KDM1A/LSD1 Abcam Cat# ab129195; RRID:AB_11145494 H3K9me3 Abcam Cat# ab176196;RRID:AB_2797591 H3K4me2 Abcam Cat# ab32356;RRID:AB_732924 H3.3 Abcam Cat# ab176840;RRID:AB_2715502 p53 Abcam Cat# ab1101;RRID:AB_297667 Tubulin Thermo Fisher Scientific Cat#62204;RRID:AB_1965960 p21/CDKN1A Abcam Cat#ab109199;RRID:AB_10861551 H3 Santa Cruz Cat#sc-8654;RRID:AB_2118303 Lamin B-1 Abcam Cat#ab16048;RRID:AB_443298 Gamma H2AX Abcam Cat#ab26350;RRID:AB_470861 CENP-C Kind Gift from Bill Earnshaw lab N/A anti-Flag Abcam Cat #ab125243;RRID:AB_11001232 Anti-HA Abcam Cat #ab9110;RRID:AB_307019 H2A Abcam Cat #ab18255;RRID:AB_470265 Goat anti-Mouse IgG (H+L) Cross-Adsorbed Secondary Antibody, Alexa Fluor 488 Thermo Fisher Scientific Cat#A-11001;RRID:AB_2534069 Goat anti-Rabbit IgG (H+L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor 546 Thermo Fisher Scientific Cat#A-11035;RRID:AB_2534093 Goat anti-Guinea Pig IgG (H+L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor 647 Thermo Fisher Scientific Cat#A-21450;RRID:AB_2535867 Biological samples Kidney asmbio Details in Table S3 Lung asmbio Details in Table S3 Chemicals, peptides, and recombinant proteins Doxorubicin hydrochloride Sigma Aldrich D1515 Dimethyl sulfoxide (DMSO) Sigma Aldrich D2650 Trans-2-Phenylcyclopropylamine hydrochloride (2-PCPA) Milipore Sigma P8511 MNase Sigma -Aldrich N3755-500UN TRIzol reagent Ambion, USA 15596026 Nonidet P40 Sigma Aldrich 74385 Colcemid Millipore Sigma 10295892001 Chloroform Fischer Chem C298500 Isopropanol Millipore Sigma 534021 Thymidine Sigma Aldrich T9250 Ethanol Decon Lab 2716 Methanol Macron Chemicals 3016-16 Acetic Acid Sigma Aldrich A6283 PBS Gibco 1490-144 Human LSD1 cDNA,N-HA tag SinoBiological HG13721 (Continued on next page) Molecular Cell 85, 1–16.e1–e7, February 20, 2025 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER Human CENPB cDNA, C-Flag tag SinoBiological HG18765 Penicillin Streptomycin Gibco 15140-122 Minimal Essential Medium (MEM) Sigma Aldrich M5650 Trypsin Thermo Fisher Scientific 25200056 FBS Fetal Bovine Serum Gibco 10438-026 Glutamine Gibco 25030-081 Poly L Lysine Sigma Aldrich P8920 Complete Protease Inhibitor Cocktail Millipore Sigma 11697498001 Protein G Sepharose GE Healthcare 17-0618-02 GreenLink Blue qPCR Mastermix BioLink laboratories 16-2200 43 Laemmli sample buffer Bio-Rad 1610747 4 to 20% Mini-PROTEAN TGX precast gels Bio-Rad 4561093 Tris-glycine SDS running buffer KD Medical #RGC-3390 Odyssey blocking buffer LI-COR 92740000 Novex Sharp Pre-stained Protein Standard Thermo Fisher Scientific LC5800 Critical commercial assays Senescence Detection Kit Abcam Catalog number# ab65351 Click-iT EdU Alexa Fluor 647 Flow Cytometry Assay Kit Thermo Fisher Scientific Catalog number# C10424 iScript Advanced cDNA Synthesis Kit Biorad, USA Catalog number #1725038 Neon Transfection System 100 mL Kit Thermo Fisher Scientific USA Catalog number #MPK10096 Deposited data RNA Seq analysis This paper GSE250322 Mass spec analysis This paper Excel data sheet attached Data S2 Raw image files This paper https://doi.org/10.17632/wzdnj532yg.1 Experimental models: Cell lines BJ Skin fibroblasts ATCC CRL-2522 IMR90 lung fibroblasts ATCC CCL-186 Human Foreskin 1y Coreill Institute AG08498 Human Foreskin 26y Coreill Institute AG09860 Human Foreskin 29y Coreill Institute AG06103 Human Foreskin 29y Coreill Institute AG04441 Human Foreskin 44y Coreill Institute AG13156 Human Foreskin 47y Coreill Institute AG06858 Human Foreskin 55y Coreill Institute AG06283 Human Foreskin 65y Coreill Institute AG04659 Human Foreskin 75y Coreill Institute AG06883 Human Skin 96y Coreill Institute GM00731 Oligonucleotides CENPA-ASO Qiagen GATAACGCACGAACAG CENPB-ASO #1 Qiagen ATGGGCCCCAAGAGGCGACAGCT CENP-B ASO #2 Qiagen ATGGGCCCCAAGAGGCGACAGCT Universal Scrambled ctrl Qiagen GACTACTACGCTCGTCA siRNA p53 ON-Target plus SMARTpool Human TP53 Dharmacon Cat#L-003329-00-0010 ON-Target plus Control Pool Non targeting pool Dharmacon Cat# D-001810-10-20 Primers used IDT DNA Table S2 (Continued on next page) e2 Molecular Cell 85, 1–16.e1–e7, February 20, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER Software and algorithms GraphPad Prism/9.0.0 (121) Dotmatics https://www.graphpad.com/d.com/ Biorender Biorender,LLC. https://www.biorender.com/ Image J National Institute of Health https://imagej.net/ij/ FlowJo FlowJo, LLC https://www.flowjo.com/ Prism v9 GraphPad https://www.graphpad.com/ DESeq2 v.1.42.0 Bioconductor https://bioconductor.org/packages/ release/bioc/html/DESeq2.html LI-COR Image Studio 5.2 LI-COR Biosciences https://www.licor.com/bio/image-studio/

cDNA Synthesis:

Amplification:

Polymerase Chain Reaction:

Article Title: Oral delivery of nerolidol alleviates cyclophosphamide-induced renal inflammation, apoptosis, and fibrosis via modulation of NF-κB/cleaved caspase-3/TGF-β signaling molecules
Article Snippet: .. The PCR process was conducted using 20 μl of the prepared sample having one μl cDNA, 500 ng/μl final concentration of primer, and EvaGreen supermix qPCR obtained from Biorad. ..

Staining:

Mass Spectrometry:

RNA sequencing:

CMC:

Sequencing:

Article Title: Oral delivery of nerolidol alleviates cyclophosphamide-induced renal inflammation, apoptosis, and fibrosis via modulation of NF-κB/cleaved caspase-3/TGF-β signaling molecules.
Article Snippet: For this assay, drug-treated hK-2 was used to isolate total RNa using an RNase commercial kit obtained from Qiagen and processed as per the manufacturer’s instruction. .. NanoDrop 1000TM obtained from thermo scientific was used for the determination of quality as well as quantity of RNa. the obtained 1 μg of RNa was used for the cDNa preparation using reverse transcription reaction obtained from Bio-Rad. the sequence of a primer used in this Rt-PcR is shown in table 1. the efficacy of the primer was evaluated by the dilution and the gradient temperature technique (50– 55). the PcR process was conducted using 20 μl of the prepared sample having one μl cDNa, 500 ng/μl final concentration of primer, and evaGreen supermix qPcR obtained from Biorad. the 2-ΔΔct method was used for the estimation of fold change, and the experiment was conducted in triplicate (heeba & Mahmoud, 2016). ..

Control:

other:

Article Title: Sugar and arginine facilitate oral tolerance by ensuring the functionality of tolerogenic immune cell subsets in the intestine.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER L-Histidine monohydrochloride monohydrate Sigma Aldrich Cat#H8125; CAS: 5934-29-2 L-Arginine monohydrochloride Sigma Aldrich Cat#A6969; CAS: 1119-34-2 L-Glutamine Sigma Aldrich Cat#G3126; CAS: 56-85-9 Putrescine TCI Cat#D0239; CAS: 119-60-1 F12 Advanced DMEM Thermo Fisher Scientific Cat#12634010 SILAC-DMEM/F12 Athena Environmental Sciences Cat#0433 L-Arginine, 1, 000x stock Athena Environmental Sciences Cat#0416 L-Lysine, 1, 000x stock Athena Environmental Sciences Cat#0417 L-Leucine 200x stock Athena Environmental Sciences Cat#0418 L-Methionine, 1, 000x stock Athena Environmental Sciences Cat#0419 Block Ace DS Pharma Biomedical Cat#UK-B80 Critical commercial assays LEGEND MAX Mouse OVA Specific IgE ELISA Kit with Pre-coated Plates Biolegend Cat#439807 ELISA MAX Mouse IgE Biolegend Cat#432403 Lamina Propria Dissociation Kit Miltenyi Biotec Cat#130-097-410 ALDEFLUOR Kit Stemcell Technologies Cat#01700 Annexin V-FITC Apoptosis Detection Kit Nacalai Tesque Cat#15342-54 Zenon Rabbit IgG Labeling Kits Alexa Fluor 647 Thermo Fisher Scientific Cat#Z25308 Foxp3/Transcription Factor Staining Buffer Set Invitrogen Cat#00-5523-00 Fixation/Permeabilization Solution Kit BD Bioscience Cat#554715 Rneasy Mini Kit QIAGEN Cat#74106 Rneasy Micro Kit QIAGEN Cat#74004 iScript Advanced cDNA Synthesis Kit for RT-qPCR BIO RAD Cat#1725038 P3 Primary Cell 4D-Nucleofector X Kit Lonza Cat#V4XP-3024 SMART-Seq V4 Ultra Low Input RNA kit for Sequencing Takara Bio Cat#634893 KAPA Library Quantification kit KAPA Biosystems Cat#KK4828 NEBNext Ultra II RNA Library Prep Kit for Illumina New England Biolabs Cat# E7770 Fragment Analyzer Qualitative DNA Kits Agilent Technologies Cat# DNF-915 Novaseq 6000 S4 Reagent Kit Illumina Cat#20027566 Arginase Activity Assay Kit Cosmo Bio Cat#AK89 Deposited data Raw RNA-Seq data (CD103+ DCs) This paper DRA016893 Raw RNA-Seq data (CX3CR1+ cells) This paper DRA016832 Experimental models: Organisms/strains Mouse: C.Cg-Tg(DO11.10)10Dlo/J (DO11.10 mice) Jaxson Laboratory Cat#003303 Mouse: BALB/cA mice CLEA Japan N/A Mouse: C57BL/6J mice CLEA Japan N/A Mouse: Arg2 KO mice From Dr. Noriko Toyama-Sorimachi N/A Oligonucleotides Silencer Select mouse Gls Thermo Fisher Scientific Cat#s66756 Silencer Select Negative Control No.1 siRNA Thermo Fisher Scientific Cat#4390843 Primer: Rpl32 Forward: GGCTTTTCGGTTCTTAGAGGA Integrated DNA Technologies N/A Primer: Rpl32 Reverse: TTCCTGGTCCACAATGTCAA-30) Integrated DNA Technologies N/A (Continued on next page) Cell Reports 43, 114490, July 23, 2024 21

Article Title: A transient MXD4-dependent proliferative pause enables survival of brain micrometastases.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Saline solution 0.9% Braun Medical Cat#: 607189 2-hydroxypropyl-β-cyclodextrin (HP-β-CD) Sigma-Aldrich Cat#: 332607 PEG300 MedChem Express Cat#: HY-Y0873 Tween 80 MedChem Express Cat#: HY-Y1891 Methanol Millipore Cat#: 1.06009.2511 Fluoromount-G Southern Biotech Cat#: 0100-01 Boric acid Sigma-Aldrich Cat#: B0394 Streptococcus pyogenes Cas9 (SpCas9) nuclease IDT Cat#: 10007806 Puromycin Merck Life Sciences Cat#: P8833 Opti-MEM Life Technologies Cat#: 51985-026 Lipofectamine 2000 Invitrogen Cat#: 11668019 Polybreene Thermo Scientific Cat#: 12965169 Higromycin Merck Life Sciences Cat#: H3274 Neomycin Sigma-Aldrich Cat#: N1876 Dithiobissuccinimidyl Propionate (DSP) Thermo Scientific Cat#: 22585 Tris-HCl pH 7.5 Life Technologies Cat#: 15567027 Epon resin Electron Microscopy Sciences Cat#: Embed 812 Critical commercial assays RNAeasy Mini Kit Qiagen Cat#: 50974104 QIAshredder Kit Qiagen Cat#: 79656 Target Retrival Solution, High pH Agilent-Dako Cat#: K8004 Target Retrival Solution, Low pH Agilent-Dako Cat#: K800521 EnVision+/HRP, Rabbit, HRP Dako Cat#: K400311-2 EnVision+/HRP, Mouse, HRP Dako Cat#: K400111-2 Sample Prep Kit Biotechne - ACD Cat#: 323740 Probe Amplification kit Biotechne - ACD Cat#: 323210 DAB Detection Kit Ventana Medical Systems Cat#: 760-159 Neon Transfection System Thermo Scientific Cat#: MPK1096 iScript cDNA Synthesis Kit Bio-Rad Cat#: 1708891 GoTaq qPCR Master Mix Promega Cat#: A6002m Brain Tumor Dissociation Kit Miltenyi Biotec Cat#: MACS 130-095-942 Debris removal solution Miltenyi Biotec Cat#: MACS 130-109-398 Chromium Next GEM Single Cell 3 ′ Reagent Kits v3.1 10× Genomics Cat#: PN-1000268 Chromium Single Cell 3 ′ GEM, Library & Gel Bead Kit v3 10× Genomics Cat#: PN-1000075 Xenium Human Multi-Tissue and Cancer Gene Expression panel 10× Genomics Cat#: 1000626 Xenium add-on custom-designed gene panel of 50 genes 10× Genomics Cat#: VDK7KG Deposited data TRAP-Seq from cells in vitro and in organotypic cultures (H2030-BrM) Er et al. 3 GEO: GSE82281 scRNA-seq of H2030-BrM micrometastases (control and shMXD4) This study GEO: GSE278126 Targeted spatial transcriptomics of human brain micrometastases This study ZENODO: 13737538 Targeted spatial transcriptomics of human brain micrometastases ZENODO: 13736216 (Continued on next page) Cancer Cell 44, 1–20.e1–e19, October 12, 2026 e3

Concentration Assay:

Article Title: Oral delivery of nerolidol alleviates cyclophosphamide-induced renal inflammation, apoptosis, and fibrosis via modulation of NF-κB/cleaved caspase-3/TGF-β signaling molecules
Article Snippet: .. The PCR process was conducted using 20 μl of the prepared sample having one μl cDNA, 500 ng/μl final concentration of primer, and EvaGreen supermix qPCR obtained from Biorad. ..

Article Title: Oral delivery of nerolidol alleviates cyclophosphamide-induced renal inflammation, apoptosis, and fibrosis via modulation of NF-κB/cleaved caspase-3/TGF-β signaling molecules.
Article Snippet: For this assay, drug-treated hK-2 was used to isolate total RNa using an RNase commercial kit obtained from Qiagen and processed as per the manufacturer’s instruction. .. NanoDrop 1000TM obtained from thermo scientific was used for the determination of quality as well as quantity of RNa. the obtained 1 μg of RNa was used for the cDNa preparation using reverse transcription reaction obtained from Bio-Rad. the sequence of a primer used in this Rt-PcR is shown in table 1. the efficacy of the primer was evaluated by the dilution and the gradient temperature technique (50– 55). the PcR process was conducted using 20 μl of the prepared sample having one μl cDNa, 500 ng/μl final concentration of primer, and evaGreen supermix qPcR obtained from Biorad. the 2-ΔΔct method was used for the estimation of fold change, and the experiment was conducted in triplicate (heeba & Mahmoud, 2016). ..

Reverse Transcription:

Article Title: Oral delivery of nerolidol alleviates cyclophosphamide-induced renal inflammation, apoptosis, and fibrosis via modulation of NF-κB/cleaved caspase-3/TGF-β signaling molecules.
Article Snippet: For this assay, drug-treated hK-2 was used to isolate total RNa using an RNase commercial kit obtained from Qiagen and processed as per the manufacturer’s instruction. .. NanoDrop 1000TM obtained from thermo scientific was used for the determination of quality as well as quantity of RNa. the obtained 1 μg of RNa was used for the cDNa preparation using reverse transcription reaction obtained from Bio-Rad. the sequence of a primer used in this Rt-PcR is shown in table 1. the efficacy of the primer was evaluated by the dilution and the gradient temperature technique (50– 55). the PcR process was conducted using 20 μl of the prepared sample having one μl cDNa, 500 ng/μl final concentration of primer, and evaGreen supermix qPcR obtained from Biorad. the 2-ΔΔct method was used for the estimation of fold change, and the experiment was conducted in triplicate (heeba & Mahmoud, 2016). ..

Review

cdna samples (Bio-Rad)

Structured Review

Images

Related Articles

Real-time Polymerase Chain Reaction:

cDNA Synthesis:

Amplification:

Polymerase Chain Reaction:

Staining:

Mass Spectrometry:

RNA sequencing:

CMC:

Sequencing:

Control:

other:

Concentration Assay:

Reverse Transcription:

Protease Inhibitor:

Blocking Assay:

Flow Cytometry:

Transfection:

RNA Sequencing:

Allele-specific Oligonucleotide:

Similar Products

Image Search Results